The answer is given!

5. Professor Clueless has just identified a novel sequence X that s VERY similar to sequence Y as shown by the alignment in Figure 16.2. On the other hand, when he uses blast to find homologs of X against genbank (Figure 16.3), he obtains VERY different results from a blastn with query sequence Y (Figure 16.4). With such similarity between X and Y, he was expecting the two queries to get very similar results. What advice will you give the Professor (10pts)? Query: 2 agcgggatacacgtgaaagtcctagcaaacatgcgaatctacgcaatagcagaagtcggc 61 Sbjct: 2 agcgggaagcacgtgcaggtcctggccaacaagcgcatcaacgccatggcagaggacggc 61 Query: 62 gaaaccttcgctaagctcaaagtggagtcagacacattaggaaacagtgttagagtacgt 121 Sbjct: 62 gaccccttcgcaaagctcatcgtggagacggacacctttggaagcagagttcgagtccga 121 Query: 122 ggagcagtgacgggaatctacatatgcatgataaagaagagaaagctaatagccatgaga 181 Sbjct: 122 ggagccgagacgggcctctacatctgcatgaacaagaaggggaagctgatcgccaagagc 181 Query: 182 aacagcaatggaaaggaatacgtcttatcggagatagtgctggtaaacaacaaaacagca 241 Sbjct: 182 aacggcaaaggcaaggactgcgtcttcacggagattgtgctggagaacaactacacagcg 241 Query: 242 ctacagattgcaaagaacgaaggatggtaaaaggccttatcccgcaaaggccggcaacgc 301 Sbjct: 242 ctgcagaatgccaagtacgagggctggtacatggccttcacccgcaagggccggccccgc 301 Query: 302 aagagatccaaaacacggctgcaacagagtgaagtacacttaaagaagcgaatgccccga 361 Sbjct: 302 aagggctccaagacgcggcagcaccagcgtgaggtccacttcatgaagcggctgccccgg 361 Query: 362 ggccacctaaccaccaaacagagactacgctacgaattcatcaaataaccgcc 414 Sbjct: 362 ggccaccacaccaccgagcagagcctgcgcttcgagttcctcaactacccgcc 414 Figure 16.2: Alignment of sequence X (query) with sequence Y (Subj Query- Sequence-X (420 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 2,201,099 sequences; 10,483,976,105 total letters Score E (bits) Value Sequences producing significant alignments gil 11322887 l emblAL445439.91 Human DNA sequence from clone RP11-3... 44 0.22 gil 16305076lgblAF360989.11AF360989 Ambystoma maculatum fibroblas...44 0.22 gi l 28571461 lref ING_002458.11 Homo sapiens actin, beta-like 1 CAC... 40 3.4 gil21536189 1 gblAC098734.31 Mus musculus BAC clone RP23-121L4 fro... gil309627881gblAC101811.3l Mus musculus chromosome 19, clone RP2... 40 3.4 gil46367633l emblAL512624.5ICNSO7EFD Human chromosome 14 DNA sequ... 40 3.4 gil46367628 emblAL929601.4ICNS08CCG Human chromosome 14 DNA sequ...40 3.4 gi l27763945l emblAL589182.4ICNS07EG2 Human chromosome 14 DNA sequ... gi l221280281gblAE014174.11 Mus musculus piebald deletion region . ..40 3.4 gi l 202795151gblAC079793.71 Homo sapiens BAC clone RP11-570L15 fr... 40 3.4 40 3.4 40 3.4 Lambda 1.37 1.31 Gapped Lambda 1.37 0.711 1.31 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 7,791,564 Number of Sequences: 2201099 Number of extensions: 7605 Number of successful extensions: 3 Number of sequences better than 10.0:0 Number of HSP's better than 10.0 without gapping: 0 Number of HSP's successfully gapped in prelim test: 2 length of query: 420 length of database: 10,483,976,105 X1: 11 (20.0 bits) X2: 15 (30.0 bits) X3: 25 (50.0 bits) S1: 12 (25.0 bits) Figure 16.3: Blastn of X against genbank. Top 10 hits are shown. -Y (420 letters) Query-sequence Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 2,201,099 sequences; 10,483,976,105 total letters Score Sequences producing significant alignments: (bits) Value gil 15147351 lref I NM_006119.21 Homo sapiens fibroblast growth fact... 833 0.0 gil465757041gblBCO69106.1l Homo sapiens fibroblast growth factor... 833 0.0 gil 11432611gblU36223.1 HSU36223 Human fibroblast grovth factor 8... 833 0.0 gil 1418263 l gblU56978. 1lHSU56978 Human fibroblast growth factor 8... 833 0.0 gil2463547l dbj ID38752.11 Homo sapiens gene for fibroblast growth... 833 0.0 gil 15147349 lref INM_033165.11 Homo sapiens fibroblast growth fact... 825 0.0 gil15147347 lref INM_033164.11 Homo sapiens fibroblast growth fact... 825 0.0 gil15147345lref INM_033163.11 Homo sapiens fibroblast growth fact... 825 0.0 gil 11848681gbl U46213.11HSU46213 Human fibroblast growth factor 8 825 0.0 gil11848661gblU46212.11HSU46212 Human fibroblast grovth factor 8... 825 0.0 Lambda 1.37 0.711 1.31 Gapped Lambda 1.370.711 1.31 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,557,010 Number of Sequences: 2201099 Number of extensions: 7152 Number of successful extensions: 80 Number of sequences better than 10.0: 0 Number of HSP's better than 10.0 without gapping: 0 Number of HSP's successfully gapped in prelim test: 69 length of query: 420 length of database: 10,483,976,105 X1: 11 (20.0 bits) X2: 15 (30.0 bits) X3: 25 (50.0 bits) S1: 12 (25.0 bits) Figure 16.4: Blastn of Y against genbank. Top 10 hits are shown. 5. Professor Clueless has just identified a novel sequence X that s VERY similar to sequence Y as shown by the alignment in Figure 16.2. On the other hand, when he uses blast to find homologs of X against genbank (Figure 16.3), he obtains VERY different results from a blastn with query sequence Y (Figure 16.4). With such similarity between X and Y, he was expecting the two queries to get very similar results. What advice will you give the Professor (10pts)? Query: 2 agcgggatacacgtgaaagtcctagcaaacatgcgaatctacgcaatagcagaagtcggc 61 Sbjct: 2 agcgggaagcacgtgcaggtcctggccaacaagcgcatcaacgccatggcagaggacggc 61 Query: 62 gaaaccttcgctaagctcaaagtggagtcagacacattaggaaacagtgttagagtacgt 121 Sbjct: 62 gaccccttcgcaaagctcatcgtggagacggacacctttggaagcagagttcgagtccga 121 Query: 122 ggagcagtgacgggaatctacatatgcatgataaagaagagaaagctaatagccatgaga 181 Sbjct: 122 ggagccgagacgggcctctacatctgcatgaacaagaaggggaagctgatcgccaagagc 181 Query: 182 aacagcaatggaaaggaatacgtcttatcggagatagtgctggtaaacaacaaaacagca 241 Sbjct: 182 aacggcaaaggcaaggactgcgtcttcacggagattgtgctggagaacaactacacagcg 241 Query: 242 ctacagattgcaaagaacgaaggatggtaaaaggccttatcccgcaaaggccggcaacgc 301 Sbjct: 242 ctgcagaatgccaagtacgagggctggtacatggccttcacccgcaagggccggccccgc 301 Query: 302 aagagatccaaaacacggctgcaacagagtgaagtacacttaaagaagcgaatgccccga 361 Sbjct: 302 aagggctccaagacgcggcagcaccagcgtgaggtccacttcatgaagcggctgccccgg 361 Query: 362 ggccacctaaccaccaaacagagactacgctacgaattcatcaaataaccgcc 414 Sbjct: 362 ggccaccacaccaccgagcagagcctgcgcttcgagttcctcaactacccgcc 414 Figure 16.2: Alignment of sequence X (query) with sequence Y (Subj Query- Sequence-X (420 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 2,201,099 sequences; 10,483,976,105 total letters Score E (bits) Value Sequences producing significant alignments gil 11322887 l emblAL445439.91 Human DNA sequence from clone RP11-3... 44 0.22 gil 16305076lgblAF360989.11AF360989 Ambystoma maculatum fibroblas...44 0.22 gi l 28571461 lref ING_002458.11 Homo sapiens actin, beta-like 1 CAC... 40 3.4 gil21536189 1 gblAC098734.31 Mus musculus BAC clone RP23-121L4 fro... gil309627881gblAC101811.3l Mus musculus chromosome 19, clone RP2... 40 3.4 gil46367633l emblAL512624.5ICNSO7EFD Human chromosome 14 DNA sequ... 40 3.4 gil46367628 emblAL929601.4ICNS08CCG Human chromosome 14 DNA sequ...40 3.4 gi l27763945l emblAL589182.4ICNS07EG2 Human chromosome 14 DNA sequ... gi l221280281gblAE014174.11 Mus musculus piebald deletion region . ..40 3.4 gi l 202795151gblAC079793.71 Homo sapiens BAC clone RP11-570L15 fr... 40 3.4 40 3.4 40 3.4 Lambda 1.37 1.31 Gapped Lambda 1.37 0.711 1.31 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 7,791,564 Number of Sequences: 2201099 Number of extensions: 7605 Number of successful extensions: 3 Number of sequences better than 10.0:0 Number of HSP's better than 10.0 without gapping: 0 Number of HSP's successfully gapped in prelim test: 2 length of query: 420 length of database: 10,483,976,105 X1: 11 (20.0 bits) X2: 15 (30.0 bits) X3: 25 (50.0 bits) S1: 12 (25.0 bits) Figure 16.3: Blastn of X against genbank. Top 10 hits are shown. -Y (420 letters) Query-sequence Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 2,201,099 sequences; 10,483,976,105 total letters Score Sequences producing significant alignments: (bits) Value gil 15147351 lref I NM_006119.21 Homo sapiens fibroblast growth fact... 833 0.0 gil465757041gblBCO69106.1l Homo sapiens fibroblast growth factor... 833 0.0 gil 11432611gblU36223.1 HSU36223 Human fibroblast grovth factor 8... 833 0.0 gil 1418263 l gblU56978. 1lHSU56978 Human fibroblast growth factor 8... 833 0.0 gil2463547l dbj ID38752.11 Homo sapiens gene for fibroblast growth... 833 0.0 gil 15147349 lref INM_033165.11 Homo sapiens fibroblast growth fact... 825 0.0 gil15147347 lref INM_033164.11 Homo sapiens fibroblast growth fact... 825 0.0 gil15147345lref INM_033163.11 Homo sapiens fibroblast growth fact... 825 0.0 gil 11848681gbl U46213.11HSU46213 Human fibroblast growth factor 8 825 0.0 gil11848661gblU46212.11HSU46212 Human fibroblast grovth factor 8... 825 0.0 Lambda 1.37 0.711 1.31 Gapped Lambda 1.370.711 1.31 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,557,010 Number of Sequences: 2201099 Number of extensions: 7152 Number of successful extensions: 80 Number of sequences better than 10.0: 0 Number of HSP's better than 10.0 without gapping: 0 Number of HSP's successfully gapped in prelim test: 69 length of query: 420 length of database: 10,483,976,105 X1: 11 (20.0 bits) X2: 15 (30.0 bits) X3: 25 (50.0 bits) S1: 12 (25.0 bits) Figure 16.4: Blastn of Y against genbank. Top 10 hits are shown.


Best answer
3.5
4
Iudician 2 answers

When BLAST alignment was done, the probability of getting similarity score was less at certain base pairs. Multiple sequence alignment test and CAT score analysis can be performed by the professor to find out hits, extension, number of sequence and HSPs for matching exact bits and getting a score greater than ten.

3.5  (4 votes )
0
Are there any questions left?
New questions in the section Biology
Sign up for the IQClass
Answers from experts with no ads!
Sign up
Develop soft skills on BrainApps
Complete the IQ Test
Made with love
This website uses cookies to make IQClass work for you. By using this site, you agree to our cookie policy

Pleased to see you again

IQClass unlocks the learning potential of every child
  • Master useful skills
  • Improve learning outcomes
  • Share your knowledge
Create an account
Sign in
Recover lost password
Or log in with

Create an account

IQClass unlocks the learning potential of every child
  • Master useful skills
  • Improve learning outcomes
  • Share your knowledge
Create an account
Sign Up
Or sign up with
By signing up, you agree to the Terms of use and Privacy policy.
Looking for an answer to a question you need help with?
you have баллов