1 Targeted Gene SBDNA sequence 2 HEATRİ AGATGGCTCACCAATGGCGA GGCCGACTGGCACTCAGGAC CAGTCAGCTAGCAAAAACCT AGTCCAAGGCTCTAATCCCA AGTCCTCATAGTTCACCACC AGACCATTGCCAGTGTTCGT TAAGCCAGCACAGAAGTGTC GTAGGCCAGCACGTGCTCCC TCGATTGTGGCCGCTTCCTT AAAGCTTCATAAGTTTGAGT TAGCACTCACCTACGAACAC AGGGACACCGCCTTCGCCAT CGGcCCCTITGAGGTCAACA CCGCAGCGAGAGCGACGCGT TTGGTGATGCGGTCGTACTT CTCCCGATACCGTCAGACCC GCAGGGTGGCCGTCGTGACC TGGCCCCCCTTCGAGGGCCA AGTAGAGTACGAGCTTCCAC CCAGTCGTTCGGCTGCTGCG CAATTCCAAGCAACTCTTCC AGTCGTCGAGCTGATGAAGA CTTACCAGAACGTTGTTTTC TAACCTTGGGATTAGAGCCT CCGGTTCATGCCGCCCATGC ACTTCCTGAAAACAACGTTC CCCGCGTGACCAGTCATTTG 5.13 1.11E-14 4.89 1.69E-07 4.04 2.48E-08 .65 1.11E-06 .11 4.11E-27 61 5.60E-13 .60 0.020025 2.17 7.28E-05 14 0.000116 98 0.03739 95 0.005348 .60 0.000206 0.64 0.347273 0.50 0.615265 0.50 0.583591 0.28 0.708809 0.23 0.826464 4 HEATR1 S POLR2D 7 POLR2D 8 HEATR1 10 HEATR1 11 POLR2D 12 POLR2D 13 HEATR1 14 MCM2 5.25 16 MCM2 17 GRIP1 20 GRIPI 0.18 0.843931 .25 0.805664 0.48 0.161874 0.85 0.463436 30 1.95E-25 3.28 3.91E-18 3.29 4.26E-28 3.36 3.45E-16 3.58 1.79E-57 3.72 5.11E-51 4.64 6.29E-29 42.44 4.72 1.31E-61 581 1.35E-73 6.61 2.07E-63 7.44 5.21E-49 22 HEATR1 25 POLR2D 164.4 193.17 242.40 231.41 349.24 28 CREBBP 9 CREBBP 0 CREBBP 1 CREBBP TCGACAATGCGGGAGCGAGC 135.07 440.20 54.25 AGCGGCTCTAGTATCAACCC GAATCACATGACGCATTGTC 735.97 1367.24 ATTCCACGGGAAGGAGATCT 57.99 1558.14 1632.13 83.134515.31 4547.53 99.659745.30 9814.11 15.28 2480.03 2696.65 CATGTGTAACAGTTCCTGCA AAACATCTCGTACAGTGACA CCTGGCTTCTTACGCCGTCC GTACTGCAGTCCAAAGAACC 100.73 37 Here is a description of each of the columns: A) Targeted Gene B) Guide sequence (this is a DNA sequence because it is the sequence encoded in the plasmid) C) logFC: log (base 2) difference in number of guides sequenced at Day 21 vs. Day 0. Negative means the number of guides is less at Day 21, positive means the number of guides increases after 21 days. D) FDR: False discovery rate: a statistical measure of how likely it is that the Day 21 guide counts are statistically different from the Day 0 guide counts. An FDR <0.05 is considered significant. E-H) normCPM: normalized counts per million (CPM) for this particular guide at each time point and for each replicate. It is normalizedto the total number of sequencing reads for all guides Answer the following questions about these results by filling in the blanks below. You may want to sort the screen data by the results in different columns by using the arrows in the top row of each column in Excel. 1) How many replicates are there at each timepoint? 2) What is the most guides that any single gene is targeted by in this dataset? (# of guides) 3) which of the following three genes is essential? HEATRI, GRIP1, or CREBBP 4) Which of the following three genes is growth-limiting,(ie limits how fast cells can proliferate)? MCM2, TP53, or TCF15 5) Which of the following genes does not affect the growth of cells? POLR2D, GRIP1, or NF2 Question 1 (1 point) The following file (I recommend opening in new tab and downloading) shows the partial results from 8 genes from a genome-wide CRISPR-Cas9 knockout screen in neural stem cells. Over 20 million human neural stem cells per replicate were infected with virus carrying a library of plasmids, each encoding a single sgRNA and Cas9 protein. The plasmids present in the cell were sequenced for the guides at Day O and after three weeks of outgrowth. 1 Targeted Gene SBDNA sequence 2 HEATRİ AGATGGCTCACCAATGGCGA GGCCGACTGGCACTCAGGAC CAGTCAGCTAGCAAAAACCT AGTCCAAGGCTCTAATCCCA AGTCCTCATAGTTCACCACC AGACCATTGCCAGTGTTCGT TAAGCCAGCACAGAAGTGTC GTAGGCCAGCACGTGCTCCC TCGATTGTGGCCGCTTCCTT AAAGCTTCATAAGTTTGAGT TAGCACTCACCTACGAACAC AGGGACACCGCCTTCGCCAT CGGcCCCTITGAGGTCAACA CCGCAGCGAGAGCGACGCGT TTGGTGATGCGGTCGTACTT CTCCCGATACCGTCAGACCC GCAGGGTGGCCGTCGTGACC TGGCCCCCCTTCGAGGGCCA AGTAGAGTACGAGCTTCCAC CCAGTCGTTCGGCTGCTGCG CAATTCCAAGCAACTCTTCC AGTCGTCGAGCTGATGAAGA CTTACCAGAACGTTGTTTTC TAACCTTGGGATTAGAGCCT CCGGTTCATGCCGCCCATGC ACTTCCTGAAAACAACGTTC CCCGCGTGACCAGTCATTTG 5.13 1.11E-14 4.89 1.69E-07 4.04 2.48E-08 .65 1.11E-06 .11 4.11E-27 61 5.60E-13 .60 0.020025 2.17 7.28E-05 14 0.000116 98 0.03739 95 0.005348 .60 0.000206 0.64 0.347273 0.50 0.615265 0.50 0.583591 0.28 0.708809 0.23 0.826464 4 HEATR1 S POLR2D 7 POLR2D 8 HEATR1 10 HEATR1 11 POLR2D 12 POLR2D 13 HEATR1 14 MCM2 5.25 16 MCM2 17 GRIP1 20 GRIPI 0.18 0.843931 .25 0.805664 0.48 0.161874 0.85 0.463436 30 1.95E-25 3.28 3.91E-18 3.29 4.26E-28 3.36 3.45E-16 3.58 1.79E-57 3.72 5.11E-51 4.64 6.29E-29 42.44 4.72 1.31E-61 581 1.35E-73 6.61 2.07E-63 7.44 5.21E-49 22 HEATR1 25 POLR2D 164.4 193.17 242.40 231.41 349.24 28 CREBBP 9 CREBBP 0 CREBBP 1 CREBBP TCGACAATGCGGGAGCGAGC 135.07 440.20 54.25 AGCGGCTCTAGTATCAACCC GAATCACATGACGCATTGTC 735.97 1367.24 ATTCCACGGGAAGGAGATCT 57.99 1558.14 1632.13 83.134515.31 4547.53 99.659745.30 9814.11 15.28 2480.03 2696.65 CATGTGTAACAGTTCCTGCA AAACATCTCGTACAGTGACA CCTGGCTTCTTACGCCGTCC GTACTGCAGTCCAAAGAACC 100.73 37 Here is a description of each of the columns: A) Targeted Gene B) Guide sequence (this is a DNA sequence because it is the sequence encoded in the plasmid) C) logFC: log (base 2) difference in number of guides sequenced at Day 21 vs. Day 0. Negative means the number of guides is less at Day 21, positive means the number of guides increases after 21 days. D) FDR: False discovery rate: a statistical measure of how likely it is that the Day 21 guide counts are statistically different from the Day 0 guide counts. An FDR